90
|
Sequenom
expected extension products Expected Extension Products, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/expected extension products/product/Sequenom Average 90 stars, based on 1 article reviews
expected extension products - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
radiolabeled universal primer m13 sequencing Radiolabeled Universal Primer M13 Sequencing, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/radiolabeled universal primer m13 sequencing/product/Thermo Fisher Average 90 stars, based on 1 article reviews
radiolabeled universal primer m13 sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
abi prism 377 Abi Prism 377, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/abi prism 377/product/Thermo Fisher Average 90 stars, based on 1 article reviews
abi prism 377 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
baculovirus transfer vector pbluebac iii Baculovirus Transfer Vector Pbluebac Iii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/baculovirus transfer vector pbluebac iii/product/Thermo Fisher Average 86 stars, based on 1 article reviews
baculovirus transfer vector pbluebac iii - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
gcactccagccagctttccgg (sequencing primer Gcactccagccagctttccgg (Sequencing Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gcactccagccagctttccgg (sequencing primer/product/Thermo Fisher Average 90 stars, based on 1 article reviews
gcactccagccagctttccgg (sequencing primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
taq dye primer cycle sequencing Taq Dye Primer Cycle Sequencing, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taq dye primer cycle sequencing/product/Thermo Fisher Average 90 stars, based on 1 article reviews
taq dye primer cycle sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Boehringer Mannheim
labeling kit Labeling Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/labeling kit/product/Boehringer Mannheim Average 90 stars, based on 1 article reviews
labeling kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Amersham Life Sciences Inc
multiprime dna labeling kit Multiprime Dna Labeling Kit, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiprime dna labeling kit/product/Amersham Life Sciences Inc Average 90 stars, based on 1 article reviews
multiprime dna labeling kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
m13/puc reverse sequencing primer 2 M13/Puc Reverse Sequencing Primer 2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13/puc reverse sequencing primer 2/product/Promega Average 90 stars, based on 1 article reviews
m13/puc reverse sequencing primer 2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Amersham Pharmacia Biotech Ltd
thermo sequenase fluorescent labeled primer cycle sequencing kit Thermo Sequenase Fluorescent Labeled Primer Cycle Sequencing Kit, supplied by Amersham Pharmacia Biotech Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/thermo sequenase fluorescent labeled primer cycle sequencing kit/product/Amersham Pharmacia Biotech Ltd Average 90 stars, based on 1 article reviews
thermo sequenase fluorescent labeled primer cycle sequencing kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Boehringer Mannheim
puc/ m13 reverse sequencing primer Puc/ M13 Reverse Sequencing Primer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/puc/ m13 reverse sequencing primer/product/Boehringer Mannheim Average 90 stars, based on 1 article reviews
puc/ m13 reverse sequencing primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
OncorMed Inc
om11 primer sequences Om11 Primer Sequences, supplied by OncorMed Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/om11 primer sequences/product/OncorMed Inc Average 90 stars, based on 1 article reviews
om11 primer sequences - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |