barcoded primer sets access array barcode library illumina sequencers Search Results


90
Sequenom expected extension products
Expected Extension Products, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/expected extension products/product/Sequenom
Average 90 stars, based on 1 article reviews
expected extension products - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher radiolabeled universal primer m13 sequencing
Radiolabeled Universal Primer M13 Sequencing, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/radiolabeled universal primer m13 sequencing/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
radiolabeled universal primer m13 sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher abi prism 377
Abi Prism 377, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/abi prism 377/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
abi prism 377 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

86
Thermo Fisher baculovirus transfer vector pbluebac iii
Baculovirus Transfer Vector Pbluebac Iii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/baculovirus transfer vector pbluebac iii/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
baculovirus transfer vector pbluebac iii - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Thermo Fisher gcactccagccagctttccgg (sequencing primer
Gcactccagccagctttccgg (Sequencing Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gcactccagccagctttccgg (sequencing primer/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
gcactccagccagctttccgg (sequencing primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher taq dye primer cycle sequencing
Taq Dye Primer Cycle Sequencing, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq dye primer cycle sequencing/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
taq dye primer cycle sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Boehringer Mannheim labeling kit
Labeling Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/labeling kit/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
labeling kit - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Amersham Life Sciences Inc multiprime dna labeling kit
Multiprime Dna Labeling Kit, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiprime dna labeling kit/product/Amersham Life Sciences Inc
Average 90 stars, based on 1 article reviews
multiprime dna labeling kit - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega m13/puc reverse sequencing primer 2
M13/Puc Reverse Sequencing Primer 2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13/puc reverse sequencing primer 2/product/Promega
Average 90 stars, based on 1 article reviews
m13/puc reverse sequencing primer 2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Amersham Pharmacia Biotech Ltd thermo sequenase fluorescent labeled primer cycle sequencing kit
Thermo Sequenase Fluorescent Labeled Primer Cycle Sequencing Kit, supplied by Amersham Pharmacia Biotech Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermo sequenase fluorescent labeled primer cycle sequencing kit/product/Amersham Pharmacia Biotech Ltd
Average 90 stars, based on 1 article reviews
thermo sequenase fluorescent labeled primer cycle sequencing kit - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Boehringer Mannheim puc/ m13 reverse sequencing primer
Puc/ M13 Reverse Sequencing Primer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/puc/ m13 reverse sequencing primer/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
puc/ m13 reverse sequencing primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
OncorMed Inc om11 primer sequences
Om11 Primer Sequences, supplied by OncorMed Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/om11 primer sequences/product/OncorMed Inc
Average 90 stars, based on 1 article reviews
om11 primer sequences - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results